Dna-Aptamer zur Hemmung von FGFR1
EP4748934
27. Mai 2026
Anmelder: Masarykova Univerzita 🇨🇿
Details
- Veröffentlichungs-Nr.
- EP4748934
- Anmeldetag
- 21. November 2024
- Veröffentlichung
- 27. Mai 2026
- Rechtsraum
- EP
- IPC
- C12N15/115, A61K31/7088
Abstract
The present invention provides a DNA aptamer having a length of up to 80 nucleotides, preferably up to 40 nucleotides, and being or containing the sequence: GGGATACAGGGCTXTGTCTATGGTGTGGATGGCGGATACC (SEQ ID NO. 1), wherein X is T or A, and wherein one to three deoxynucleotides may optionally be modified by fluorination. The DNA aptamers according to the invention are selective FGFR1 inhibitors and are useful in the treatment of skeletal disorders, developmental disorders, and cancers caused by aberrant FGFR1 signaling.
Anmelder
- Firma
- Masarykova Univerzita
- Land
- 🇨🇿 Tschechien