Harber IP s.r.o

The present invention belongs the field of biomedicine, namely, treating and preventing Parkinson's and Alzheimer's diseases. These diseases are characterized by the presence of amyloid fibrils that drive the pathology progression in the brains of affected individuals. The invention discloses peptides that block ends of amyloid fibrils and stop their growth.

The present invention provides a method for preparation of fully ¹³C isotopically labeled biomolecules or biomolecules having a predetermined ¹³C isotopic labeling by biosynthesis in a mammalian cell line, which comprises the following steps:a) providing a mammalian cell line capable of growing in serum-free media;b) culturing the cell line obtained in step b) in a serum-free medium containing: fully ¹³C isotopically labeled amino acids or ¹³C isotopically labeled amino acids, fully ¹³C isotopically labeled glucose and/or fully ¹³C isotopically labeled galactose, or ¹³C isotopically labeled glucose and/or ¹³C isotopically labeled galactose, fully ¹³C isotopically labeled choline or ¹³C isotopically labeled choline, vitamins, distilled water, insulin, transferrin, sodium selenite, and inorganic salts wherein when the inorganic salt contains carbon, it is preferably fully ¹³C isotopically labeled;c) obtaining ¹³C isotopically labeled biomolecules from the cells or medium after the cultivation of step b).The resulting biomolecules and their mixtures are suitable for use as internal standards in metabolomics and fluxonics, as well as in biotechnological research as standards or markers.

The present invention relates to a method for detonation synthesis of diamond particles, which comprises the steps of i) providing a detonable liquid-based mixture, comprising at least one explosive and at least one non-explosive organic compound, wherein the mixture is stoichiometrically adjusted to have a negative oxygen balance; and wherein said detonable liquid-based mixture is selected from a detonable solution, and a detonable suspension; ii) detonating said detonable liquid-based mixture in a processing container; iii) separating the diamond product.

The invention discloses a metallogel of folic acid and a metal salt. Furthermore, the invention relates to a kit for forming metallogel in an oil reservoir, comprising folic acid solution and a metal salt solution. An aspect of the invention is a method of extracting oil from an oil reservoir using a metallogel, comprising the step of injecting a folic acid solution and a metal salt solution into the oil reservoir.

The present invention relates to a method of detection of glycated proteins, particularly gHSA, which comprises the steps of:i) providing anthracene boronic acid methacrylate (ABAM): 10-[N-methyl-N-(o-boronobenzyl)aminomethyl]-anthracene-9-methyl methacrylate;ii) preparing a solution of ABAM in a biocompatible buffer with pH in the range of from 6.5 to 8.5 or in in vitro blood plasma sample of a healthy subject;iii) measuring initial fluorescence intensity of ABAM solution from step ii) at the wavelength of from 410 to 520 nm;iv) in vitro mixing of a known amount of ABAM solution from step ii) with a known amount of biological sample;v) measuring fluorescence intensity of the mixture from step iv) at the wavelength of from 410 to 520 nm;vi) determining the fluorescence intensity increases between the initial control fluorescence intensity measured in step iii) and the fluorescence intensity of the mixture of ABAM and biological sample measured in step v);vii) calculating the amount of glycated proteins in the biological sample.The present invention further relates to the use of this method in determination of the total concentrations of glycated proteins, particularly gHSA, in plasma samples and diagnostics for diabetes mellitus.

The present invention provides a method for depositing a metal or metal oxide onto a sample by focused charged particle beam induced deposition, wherein the sample is introduced into a working chamber of a focused charged particle beam device, and subjected to processing by a beam containing focused charged particles and by a stream of a gaseous precursor of the metal or metal oxide to be deposited and water vapor, wherein the gaseous precursor of the metal or metal oxide to be deposited and water vapor are produced in one reservoir from a liquid or solid precursor of the metal or metal oxide to be deposited and from a liquid or solid precursor of water vapor, and introduced from the reservoir into the working chamber by a single nozzle.

Zusammenfassung wird geladen …

The present invention provides a DNA aptamer having a length of up to 80 nucleotides, preferably up to 40 nucleotides, and being or containing the sequence: GGGATACAGGGCTXTGTCTATGGTGTGGATGGCGGATACC (SEQ ID NO. 1), wherein X is T or A, and wherein one to three deoxynucleotides may optionally be modified by fluorination. The DNA aptamers according to the invention are selective FGFR1 inhibitors and are useful in the treatment of skeletal disorders, developmental disorders, and cancers caused by aberrant FGFR1 signaling.

The present invention relates to the use of compounds of formula I <img class="EMIRef" id="f21b92c1-b97c-4642-b676-cf774b36861d-ia01" /> for treatment of metabolic disease, wherein R<1>, R<2>, R<3> are independently selected from the group consisting of phenyl, benzyl, and cyclohexyl; Z is a linear alkylene, alkenylene or alkynylene chain with the number of carbon atoms in the range of from 6 to 20, wherein one or more -CH<2>- groups may optionally be substituted with one or more O atoms; R<4> is selected from the group consisting of H, OH, halogen atom, and (C1 to C10)alkoxy group, which may optionally be substituted with one or more -OH groups; and A<-> is a pharmaceutically acceptable anion of an organic or inorganic acid.

The invention relates to salts of inorganic and organic origin (ammonium salts) of exo-16,17-dihydrogibberellin A<5> and 2,3-dehydro-exo-16,17-dihydrogibberellin A<9> derivatives, their use in agriculture, and preparations containing these compounds. The compounds of the invention are particularly suitable for agricultural and biotechnological uses, and their great advantage is increased efficiency, water solubility and bioavailability, which leads to higher crop yields.